ID: 953980572_953980588

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 953980572 953980588
Species Human (GRCh38) Human (GRCh38)
Location 3:47411012-47411034 3:47411060-47411082
Sequence CCCTCGTCTGCTGGCCAGTCCAC CCTGCCCCATCTCCAGGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102} {0: 1, 1: 0, 2: 5, 3: 90, 4: 688}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!