ID: 953985531_953985538

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 953985531 953985538
Species Human (GRCh38) Human (GRCh38)
Location 3:47439596-47439618 3:47439637-47439659
Sequence CCAGGGCAGGTTCAGATTAACAG GCTGCTGCTGGGACATATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 108} {0: 1, 1: 0, 2: 0, 3: 20, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!