ID: 953995034_953995048

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 953995034 953995048
Species Human (GRCh38) Human (GRCh38)
Location 3:47513237-47513259 3:47513280-47513302
Sequence CCGCCTCGGCCTCCCAAACTGCT CCGCGCCCGGCCGCTTCCCAGGG
Strand - +
Off-target summary {0: 998, 1: 94644, 2: 191345, 3: 138453, 4: 87012} {0: 1, 1: 0, 2: 1, 3: 22, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!