ID: 954001921_954001924

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 954001921 954001924
Species Human (GRCh38) Human (GRCh38)
Location 3:47564416-47564438 3:47564432-47564454
Sequence CCTCACTCGGTGCTTCTCCAGAG TCCAGAGGCCCAGATTAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 151} {0: 1, 1: 0, 2: 1, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!