ID: 954011224_954011229

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 954011224 954011229
Species Human (GRCh38) Human (GRCh38)
Location 3:47640714-47640736 3:47640744-47640766
Sequence CCCTACCTCAGTCTATGATACCA TTTGATTCACAAATCAAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 120, 4: 1302} {0: 1, 1: 0, 2: 2, 3: 23, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!