ID: 954036651_954036659

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 954036651 954036659
Species Human (GRCh38) Human (GRCh38)
Location 3:47854492-47854514 3:47854529-47854551
Sequence CCTGAACCCGAGCAGCAGCAGCC GGTCTGCAAGATGCCCCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 328} {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!