ID: 954089977_954089994

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 954089977 954089994
Species Human (GRCh38) Human (GRCh38)
Location 3:48276604-48276626 3:48276652-48276674
Sequence CCACTGACCCCGTGCCTTGCTTA GTTGGGAGATATGTTCTCAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 131} {0: 3, 1: 1, 2: 1, 3: 13, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!