ID: 954105313_954105322

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 954105313 954105322
Species Human (GRCh38) Human (GRCh38)
Location 3:48406698-48406720 3:48406728-48406750
Sequence CCCCAACCAGCTCACAGGGCTGC CCCAAGGGCTTCCCTGCAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 262} {0: 1, 1: 0, 2: 1, 3: 22, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!