ID: 954108317_954108328

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 954108317 954108328
Species Human (GRCh38) Human (GRCh38)
Location 3:48420806-48420828 3:48420840-48420862
Sequence CCACAGGGAAGCCCAGGCCTGGG GAACTCACTGCGCAGATGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 108, 4: 701} {0: 1, 1: 0, 2: 0, 3: 10, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!