ID: 954116361_954116369

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 954116361 954116369
Species Human (GRCh38) Human (GRCh38)
Location 3:48468951-48468973 3:48469004-48469026
Sequence CCACATATACAGGCAGGACACAC CTGGACACACACAGCACACATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 14, 4: 155} {0: 1, 1: 1, 2: 5, 3: 46, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!