ID: 954133703_954133708

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 954133703 954133708
Species Human (GRCh38) Human (GRCh38)
Location 3:48572510-48572532 3:48572524-48572546
Sequence CCCTTTGCTCCAGGGAGCCCGAC GAGCCCGACCACAGCCTGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134} {0: 1, 1: 0, 2: 3, 3: 18, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!