ID: 954138136_954138143

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 954138136 954138143
Species Human (GRCh38) Human (GRCh38)
Location 3:48591700-48591722 3:48591732-48591754
Sequence CCACCTCGTGGCCCTCCAGCAGA GTGAGGCGGTACTCAGTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 182} {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!