ID: 954149572_954149580

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 954149572 954149580
Species Human (GRCh38) Human (GRCh38)
Location 3:48650671-48650693 3:48650708-48650730
Sequence CCCACTGCCCGCCACTCCTGCTG GACCTGTCAGATTCTGTGACAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 318} {0: 1, 1: 0, 2: 0, 3: 16, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!