ID: 954152119_954152122

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 954152119 954152122
Species Human (GRCh38) Human (GRCh38)
Location 3:48662786-48662808 3:48662800-48662822
Sequence CCATCTACTCCGCGGCCGGAGCC GCCGGAGCCCCTCCGGCGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90} {0: 1, 1: 0, 2: 0, 3: 3, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!