ID: 954159259_954159269

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 954159259 954159269
Species Human (GRCh38) Human (GRCh38)
Location 3:48708769-48708791 3:48708820-48708842
Sequence CCAATAAGTAATGGTTCCATAGG TCCTAGCACTTTGGAGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 89, 4: 103} {0: 30, 1: 449, 2: 1276, 3: 2305, 4: 3908}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!