ID: 954200757_954200776

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 954200757 954200776
Species Human (GRCh38) Human (GRCh38)
Location 3:49021901-49021923 3:49021953-49021975
Sequence CCCCGGGACTATGGGCAAGGGCC CTGGAGCTGCGCCGGAGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 90} {0: 1, 1: 0, 2: 0, 3: 13, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!