ID: 954200939_954200952

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 954200939 954200952
Species Human (GRCh38) Human (GRCh38)
Location 3:49022710-49022732 3:49022759-49022781
Sequence CCACCAGGACATCACCGAAGACA CCCCGGATAGGTACTGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 137} {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!