ID: 954253234_954253241

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 954253234 954253241
Species Human (GRCh38) Human (GRCh38)
Location 3:49384800-49384822 3:49384852-49384874
Sequence CCTGTAATCCAAGTACTTTGGGA GGAGTTCGAAACCAGCAGCCTGG
Strand - +
Off-target summary {0: 75, 1: 10562, 2: 329650, 3: 262565, 4: 136163} {0: 1, 1: 13, 2: 37, 3: 105, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!