|
Left Crispr |
Right Crispr |
Crispr ID |
954253234 |
954253241 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:49384800-49384822
|
3:49384852-49384874
|
Sequence |
CCTGTAATCCAAGTACTTTGGGA |
GGAGTTCGAAACCAGCAGCCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 75, 1: 10562, 2: 329650, 3: 262565, 4: 136163} |
{0: 1, 1: 13, 2: 37, 3: 105, 4: 256} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|