|
Left Crispr |
Right Crispr |
Crispr ID |
954253236 |
954253241 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:49384808-49384830
|
3:49384852-49384874
|
Sequence |
CCAAGTACTTTGGGAGGCTCAGA |
GGAGTTCGAAACCAGCAGCCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 314, 2: 11045, 3: 134688, 4: 332008} |
{0: 1, 1: 13, 2: 37, 3: 105, 4: 256} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|