ID: 954253236_954253241

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 954253236 954253241
Species Human (GRCh38) Human (GRCh38)
Location 3:49384808-49384830 3:49384852-49384874
Sequence CCAAGTACTTTGGGAGGCTCAGA GGAGTTCGAAACCAGCAGCCTGG
Strand - +
Off-target summary {0: 3, 1: 314, 2: 11045, 3: 134688, 4: 332008} {0: 1, 1: 13, 2: 37, 3: 105, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!