ID: 954294137_954294154

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 954294137 954294154
Species Human (GRCh38) Human (GRCh38)
Location 3:49664868-49664890 3:49664899-49664921
Sequence CCTGTACCTTGCCTCTTCTGGGA AGGCACTGGGGGTGGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155} {0: 1, 1: 7, 2: 55, 3: 450, 4: 2579}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!