ID: 954318385_954318392

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 954318385 954318392
Species Human (GRCh38) Human (GRCh38)
Location 3:49813609-49813631 3:49813636-49813658
Sequence CCCTGAATCCTCTGCATGGCAGG CCCAGCACATACCTGTGGATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 201} {0: 1, 1: 0, 2: 2, 3: 13, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!