ID: 954342288_954342291

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 954342288 954342291
Species Human (GRCh38) Human (GRCh38)
Location 3:49964471-49964493 3:49964514-49964536
Sequence CCTGTTTTTGTAAATAAAGTTTT ACTCATTTGCAGATTGTGTATGG
Strand - +
Off-target summary {0: 330, 1: 802, 2: 1023, 3: 995, 4: 1555} {0: 1, 1: 1, 2: 3, 3: 50, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!