ID: 954377990_954378002

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 954377990 954378002
Species Human (GRCh38) Human (GRCh38)
Location 3:50205057-50205079 3:50205103-50205125
Sequence CCCCACAAGACTCAACGGAGTCC CTAGGGGCTCCCTAACGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54} {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!