ID: 954379696_954379706

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 954379696 954379706
Species Human (GRCh38) Human (GRCh38)
Location 3:50213028-50213050 3:50213062-50213084
Sequence CCCAGCCACCTCTGGTTATGAGG TGGACCCAGTGATGGGAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 143} {0: 1, 1: 0, 2: 4, 3: 43, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!