ID: 954406040_954406054

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 954406040 954406054
Species Human (GRCh38) Human (GRCh38)
Location 3:50345551-50345573 3:50345596-50345618
Sequence CCGGGCAGCAGCAGTTCCAGGTC GGCGGATCCTGGGCAGCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 269} {0: 1, 1: 0, 2: 1, 3: 15, 4: 278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!