ID: 954417928_954417936

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 954417928 954417936
Species Human (GRCh38) Human (GRCh38)
Location 3:50403167-50403189 3:50403187-50403209
Sequence CCAAAACACTGCCAGGGCCCCTC CTCCCAGGGCTGTGAGGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 228} {0: 1, 1: 0, 2: 7, 3: 73, 4: 618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!