ID: 954426357_954426363

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 954426357 954426363
Species Human (GRCh38) Human (GRCh38)
Location 3:50445275-50445297 3:50445297-50445319
Sequence CCCACAGTGGACTCTGAACCAGG GGTCCCAGGAGAGCCCAGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 177} {0: 1, 1: 0, 2: 7, 3: 42, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!