ID: 954431143_954431154

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 954431143 954431154
Species Human (GRCh38) Human (GRCh38)
Location 3:50471441-50471463 3:50471484-50471506
Sequence CCAGCTTCCTTCTTCCTCTTCTG TGAGGTTCCCTGGCACTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 206, 4: 1491} {0: 1, 1: 0, 2: 1, 3: 5, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!