ID: 954463284_954463288

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 954463284 954463288
Species Human (GRCh38) Human (GRCh38)
Location 3:50639814-50639836 3:50639839-50639861
Sequence CCCAGCACCTTCTGCTTCTACAC ACATTTCTCATAGATGCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 230} {0: 1, 1: 0, 2: 1, 3: 19, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!