ID: 954491478_954491489

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 954491478 954491489
Species Human (GRCh38) Human (GRCh38)
Location 3:50910709-50910731 3:50910755-50910777
Sequence CCCACAGTCACTTTGTTCTCCCT TCCATGTGCTGATGGTGGATGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 29, 3: 111, 4: 395} {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!