ID: 954502196_954502200

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 954502196 954502200
Species Human (GRCh38) Human (GRCh38)
Location 3:51029305-51029327 3:51029335-51029357
Sequence CCAGCAGGTAGGCTTTTACTTAG TTGCTCACCCTCTGCGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 123} {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!