ID: 954510786_954510790

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 954510786 954510790
Species Human (GRCh38) Human (GRCh38)
Location 3:51123102-51123124 3:51123129-51123151
Sequence CCAGGGTGTGGTCAGCCATAACC CGTAGCTTCATTCCACTGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78} {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!