ID: 954646220_954646226

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 954646220 954646226
Species Human (GRCh38) Human (GRCh38)
Location 3:52133199-52133221 3:52133225-52133247
Sequence CCGCCCTTCCACCTTCTGCATGT GACAGTGTTACTCCCCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 594} {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!