ID: 954647479_954647488

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 954647479 954647488
Species Human (GRCh38) Human (GRCh38)
Location 3:52140437-52140459 3:52140482-52140504
Sequence CCGGTGGCAGGAGGGTGCAGAAG TGGGCTTCCCAGCACCATCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 331} {0: 1, 1: 0, 2: 0, 3: 25, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!