ID: 954710880_954710887

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 954710880 954710887
Species Human (GRCh38) Human (GRCh38)
Location 3:52504556-52504578 3:52504580-52504602
Sequence CCCTCCCCATGGTGGAGCTGGCC CTGGCCCTCACCTCCTCCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 233} {0: 1, 1: 0, 2: 7, 3: 81, 4: 733}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!