ID: 954720176_954720189

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 954720176 954720189
Species Human (GRCh38) Human (GRCh38)
Location 3:52554782-52554804 3:52554832-52554854
Sequence CCCCCCAGGGTGAAGTGGCTGCA CTGGGCCCTGCAAAGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 236} {0: 1, 1: 0, 2: 1, 3: 23, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!