ID: 954731132_954731142

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 954731132 954731142
Species Human (GRCh38) Human (GRCh38)
Location 3:52663225-52663247 3:52663275-52663297
Sequence CCAAGCTTTCATTTCCAAGGCTT GGTCAGGGTCTACCAGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 262} {0: 1, 1: 0, 2: 0, 3: 16, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!