ID: 954761390_954761399

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 954761390 954761399
Species Human (GRCh38) Human (GRCh38)
Location 3:52877261-52877283 3:52877288-52877310
Sequence CCCTCCACCTTCACATGCCTCAG CTGCCACTGGCTGCGGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 389} {0: 1, 1: 0, 2: 2, 3: 37, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!