ID: 954767727_954767732

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 954767727 954767732
Species Human (GRCh38) Human (GRCh38)
Location 3:52935288-52935310 3:52935338-52935360
Sequence CCAGGATTTACAAGCTACAACTC TTTTGTTAATAAAGTTTTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63} {0: 2, 1: 109, 2: 997, 3: 1523, 4: 2027}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!