ID: 954842739_954842747

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 954842739 954842747
Species Human (GRCh38) Human (GRCh38)
Location 3:53526219-53526241 3:53526249-53526271
Sequence CCCTCGACCTGGGGAGGAGCCAA CTAAGTTCCTGGGCTAAGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134} {0: 1, 1: 0, 2: 0, 3: 12, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!