ID: 954914671_954914676

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 954914671 954914676
Species Human (GRCh38) Human (GRCh38)
Location 3:54138718-54138740 3:54138751-54138773
Sequence CCATCCTCATTCTGCATTTGGGG CAAGATCACGAAGCTAGTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 219} {0: 1, 1: 0, 2: 1, 3: 52, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!