ID: 954922579_954922583

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 954922579 954922583
Species Human (GRCh38) Human (GRCh38)
Location 3:54204373-54204395 3:54204404-54204426
Sequence CCGGAGAACCTTGGCTAATATAA TCCTATGTGCACAAACATCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 44, 4: 185} {0: 1, 1: 1, 2: 0, 3: 12, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!