ID: 954923686_954923695

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 954923686 954923695
Species Human (GRCh38) Human (GRCh38)
Location 3:54213922-54213944 3:54213968-54213990
Sequence CCGGGAGGAGAGAGGCCCAGGAA CTGGGTCAACCCTACTGTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 55, 4: 474} {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!