ID: 954972523_954972531

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 954972523 954972531
Species Human (GRCh38) Human (GRCh38)
Location 3:54663330-54663352 3:54663358-54663380
Sequence CCTCCTGTTGTCTTCAGCCCTTC TCCAGGGGCAGTGTGAGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 261} {0: 1, 1: 0, 2: 4, 3: 25, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!