ID: 954973021_954973028

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 954973021 954973028
Species Human (GRCh38) Human (GRCh38)
Location 3:54667361-54667383 3:54667378-54667400
Sequence CCATAATCTGTAACCACCCTCCA CCTCCAAGGCAGAGGCTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 136} {0: 1, 1: 0, 2: 2, 3: 56, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!