ID: 954994505_954994507

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 954994505 954994507
Species Human (GRCh38) Human (GRCh38)
Location 3:54869326-54869348 3:54869355-54869377
Sequence CCAAATGCATTATGGGCAATAAA TTAAAGAAGCAGAATTAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 214} {0: 1, 1: 0, 2: 1, 3: 49, 4: 573}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!