|
Left Crispr |
Right Crispr |
Crispr ID |
955014540 |
955014545 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:55057199-55057221
|
3:55057238-55057260
|
Sequence |
CCAGCCACGTGGAACCGTGAGTC |
TTTATAAATTATCCAGTCTCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 11, 1: 635, 2: 4748, 3: 7908, 4: 8118} |
{0: 575, 1: 7750, 2: 14082, 3: 14112, 4: 10506} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|