ID: 955014540_955014545

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 955014540 955014545
Species Human (GRCh38) Human (GRCh38)
Location 3:55057199-55057221 3:55057238-55057260
Sequence CCAGCCACGTGGAACCGTGAGTC TTTATAAATTATCCAGTCTCAGG
Strand - +
Off-target summary {0: 11, 1: 635, 2: 4748, 3: 7908, 4: 8118} {0: 575, 1: 7750, 2: 14082, 3: 14112, 4: 10506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!