ID: 955084449_955084454

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 955084449 955084454
Species Human (GRCh38) Human (GRCh38)
Location 3:55689037-55689059 3:55689052-55689074
Sequence CCATATTTTAAAAGACACACTGG CACACTGGGGTGTCTCTCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 305} {0: 1, 1: 0, 2: 1, 3: 11, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!