ID: 955093596_955093603

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 955093596 955093603
Species Human (GRCh38) Human (GRCh38)
Location 3:55775357-55775379 3:55775407-55775429
Sequence CCTTGTCTCTACTAAAACTACAA CTGTGGTTCGAGCTCTCAGGAGG
Strand - +
Off-target summary {0: 945, 1: 67188, 2: 163643, 3: 186387, 4: 117378} {0: 1, 1: 0, 2: 9, 3: 71, 4: 354}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!