ID: 955146555_955146560

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 955146555 955146560
Species Human (GRCh38) Human (GRCh38)
Location 3:56325788-56325810 3:56325825-56325847
Sequence CCATCCCCTTTCTACAGATGAGA AGAGAAAAGTCACTTGCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 140, 4: 587} {0: 1, 1: 1, 2: 20, 3: 149, 4: 818}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!